Skip to main content

Table 1 PCR primers used to detect β-lactamase genes, PMQR genes and E. coli phylogenetic groups

From: Multiresistant extended-spectrum β-lactamase-producing Enterobacteriaceae from humans, companion animals and horses in central Hesse, Germany

Primer Sequence (5’ - 3’) Target Size of product (bp) Reference
TEM_f ATGAGTATTCAACATTTCCG bla TEM 851 [11]
TEM_r TTAATCAGTGAGGCACCTAT
SHV_f GCAAAACGCCGGGTTATTC bla SHV 940 [11]
SHV_r GGTTAGCGTTGCCAGTGCT
CTX-M_f TCTTCCAGAATAAGGAATCCC bla CTX-M 909 [12]
CTX-M_r CCGTTTCCGCTATTACAAAC
OXA-1_f AGCAGCGCCAGTGCATCA bla OXA-1 700 [13]
OXA-1_r ATTCGACCCCAAGTTTCC
OXA-48_f AAATCACAGGGCGTAGTTGTG bla OXA-48 555 [11]
OXA-48_r GACCCACCAGCCAATCTTAG
qnrA_f AGAGGATTTCTCACGCCAGG qnrA 619 [14]
qnrA_r GCAGCACTATKACTCCCAAGG
qnrB_f GGMATHGAAATTCGCCACTG qnrB 264 [16]
qnrB_r TTTGCYGYYCGCCAGTCGAA
qnrC_f GGGTTGTACATTTATTGAATC qnrC 447 [17]
qnrC_r TCCACTTTACGAGGTTCT
qnrD_f CGAGATCAATTTACGGGGAATA qnrD 582 [18]
qnrD_r AACAAGCTGAAGCGCCTG
qnrS_f GCAAGTTCATTGAACAGGCT qnrS 428 [16]
qnrS_r TCTAAACCGTCGAGTTCGGCG
qepA_f CTGCAGGTACTGCGTCATG qepA 403 [15]
qepA_r CGTGTTGCTGGAGTTCTTC
aac_f TTGCGATGCTCTATGAGTGGCTA aac(6’)-Ib 482 [19]
aac_r CTCGAATGCCTGGCGTGTTT
chuA.1 GACGAACCAACGGTCAGGAT chuA 279 [21]
chuA.2 TGCCGCCAGTACCAAAGACA
YjaA.1 TGAAGTGTCAGGAGACGCTG yajA 211 [21]
YjaA.2 ATGGAGAATGCGTTCCTCAAC
TspE4C2.1 GAGTAATGTCGGGGCATTCA TspE4C2 152 [21]
TspE4C2.2 CGCGCCAACAAAGTATTACG