Skip to main content

Table 2 Primers Used in This Study

From: Regulated proteolysis of the alternative sigma factor SigX in Streptococcus mutans: implication in the escape from competence

Primers* Nucleotide Sequence (5′ - > 3′) Purpose
ComX-F1 CGGGATCC ATGGAAGAAGATTTTGAAATTG GST fusion
ComX-Not1-B AAGCGGCCGC AGGTACAATCACATGTTCCATTC
MecA-F1 CGGGATCC ATGGAAATGAAACAAATCAGC GST fusion
MecA-Not1-B AAGCGGCCGC AGGTATCATCTAGCTTATCCAATC
ClpC-F1 CGGGATCC CCATCTATGACCGATTACTCA GST fusion
ClpC-Not1-B AAGCGGCCGC AGGACACTGAAGTAGGGTAAAG
ClpP-F1 CGGGATCC ATGATTCCTGTAGTTATTGA GST fusion
ClpP-Not1-B AAGCGGCCGC ACATGGTTTTTCTACTCAAC
ComX-BamH1-F CGGGATCC CATGGAAGAAGATTTTGAAATTG His fusion
ComX-B3 AAGCGGCCGC TTTTTCCTTAAAATCACTTAATTT
MecA-BamH1-F CGGGATCC CATGGAAATGAAACAAATCAGC His fusion
MecA-B3 AAGCGGCCGC TCCAATCATTTGTAATTCTTGC
ClpC-BamH1-F CGGGATCC CCCATCTATGACCGATTACTCA His fusion
ClpC-B3 AAGCGGCCGC TACAATATCAAATTTTAATTTTTC
ClpP-BamH1-F CGGGATCC CATGATTCCTGTAGTTATTGA His fusion
ClpP-B3 AAGCGGCCGC TTTTAATTCATTATTTTCCA
NTD-BamH1-F CGGGATCC GATGGAAATGAAACAAATCAGC NTD-His fusion
NTD-Not1-B AAGCGGCCGC TTTATTGATTTCTGACTTAGTGACA
CTD-BamH1-F CGGGATCC GTTGGCTGAAATTGAAAAAAGAGA CTD-His fusion
CTD-Not1-B AAGCGGCCGC TCCAATCATTTGTAATTCTTGCAG
MecA-EcoR1-F1 CGGAATTC CACTTTCTTTCTCGGAATACC MecA-His
MecA-Not1-B1 AAGCGGCCGC TCCAATCATTTGTAATTCTTGC
MecA-BamH1-B2 CGGGATCC CAAAAAACCCCTCAAGACC
ClpC-BamH1-F CGGGATCC TAGCGAGCAAGTTTTTACA ClpC-His
ClpC-Not1-B1 AAGCGGCCGC TATGAAAAATAGACTAGATAAGTAT
ClpC-Not1-B2 AAGCGGCCGC TACAATATCAAATTTTAATTTTTC
ClpP-EcoR1-F CGGAATTC CGAGCTTAAAATGGGATAAC ClpP-His
ClpP-Not1-B1 AAGCGGCCGC GTATTTTAATTCATTATTTTCCAT
ClpP-Not1-B2 AAGCGGCCGC TTTTAATTCATTATTTTCCATGA
Pldh-Sac1-F CGAGCTC CCGAGCAACAATAACACTC Pldh cloning
Pldh-Spe1-B GGACTAGT AACATCTCCTTATAATTTATTAAGTATATATTCTAT
MecA-Ox-F GGACTAGT ATGGAAATGAAACAAATCAGC MecA over expression
MecA-Ox-B CGGGATCC CAAAAAACCCCTCAAGACC
  1. *:The engineered restriction sites are italicized: GGATCC: BamH1; GCGGCCGC: Not1; GAATCC: EcoR1; GAGCTC: Sac1; ACTAGT: Spe1.