Skip to main content

Table 3 Candida albicans primers for real time qPCR

From: Biofilms formed by Candida albicans bloodstream isolates display phenotypic and transcriptional heterogeneity that are associated with resistance and pathogenicity

Gene Sequence (5' - 3')
ALS1 F - TTCTCATGAATCAGCATCCACAA
R - CAGAATTTTCACCCATACTTGGTTTC
ALS3 F - CAACTTGGGTTATTGAAACAAAAACA
R - AGAAACAGAAACCCAAGAACAACCT
ALS5 F - CTGCCGGTTATCGTCCATTTA
R - ATTGATACTGGTTATTATCTGAGGGAGAAA
EAP1 F - ACCACCACCGGGTATACAAA
R - GCCATCACATTTGGTGACAG
HWP1 F - GCTCAACTTATTGCTATCGCTTATTACA
R - GACCGTCTACCTGTGGGACAGT
BCR1 F - ATTGCCACCAATACCTGCTC
R - GGCTGTCCATGTTGTTGTTG
CPH1 F - ACGCAGCCACAAGCTCTACT
R - GTTGTGTGTGGAGGTTGCAC
EFG1 F - CCAGTGGTGGCAGTAATGTG
R - CAGTGGCAGCCTTGGTATTT
TUP1 F - GCTTCAGGTAACCCATTGTTGAT
R - CTTCGGTTCCCTTTGAGTTTAGG
OCH1 F - TCATCCAATGTTGCGTGAAT
R - TCATGATATCGCCACCTTCA
PMR1 F - GAATCCCCGCAGACATTAGA
R - GGGCCTGTTTTCACCAGTTA
MNN4 F - TGAGCAATCGTCAAAACCAG
R - GGCGGTTGTCATTTGTTGAT
MNT2 F - CGTCAAGGTGCCTGAAGAAT
R - GAGGAGGAGGAGGATTTTGG
CDR1 F - GTACTATCCATCAACCATCAGCACTT
R - GCCGTTCTTCCACCTTTTTGTA
MDR1 F - TCAGTCCGATGTCAGAAAATGC
R - GCAGTGGGAATTTGTAGTATGACAA
ZAP1 F - CGACTACAAACCACCAGCTTCATC
R - CCCCTGTTGCTCATGTTTTGTT
ACT1 F - AAGAATTGATTTGGCTGGTAGAGA
R - TGGCAGAAGATTGAGAAGAAGTTT