Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Host stress hormone norepinephrine stimulates pneumococcal growth, biofilm formation and virulence gene expression

Primer ID Primer Sequence (5’-3’) Target gene in D39
SPD0014RTF GAAGGCATGCTCTGCTTACA comX
SPD0014RTR CGCTTCTGACTTTCCTGCTT
SPD0063RTF ATCCCAATCATCGGTGGTA strH
SPD0063RTR CGGTTCAGGTCTTTTGGTA
SPD0065RTF GGACCTCTTTGTAACAGGAA bga3
SPD0065RTR CATCTGCCAATTCCTTAGGA
SPD0126F GGAATGAAGGAAGATGATGC pspA
SPD0126R GCCATCTACAGTTGTGTTG
SPDRT0144F GGCGAGAAAGCTTAAGCAGA rgg
SPDRT0144R TTGTGCCCAAACTCATCAAA
SPD0344RTF GCAGAAAAATTGAGCCGAAC ritR
SPD0344RTR CGAAATACGCGCTACCAGAT
SPD0420RTF TGGTGTTTACGCACGTCTTG pflB
SPD0420RTR CATCAACCCCGTAAAGGTCAC
SPD0709RTF TCGTGTGGCTGCCAAGCGTG gyrB
SPD0709RTR GGCTGATCCACCAGCTGAGTC
SPD0722RTF CGTCACCTTCACATGACACC spxB
SPD0722RTR CATGTTGAATGCTCCGTCAC
SPD0939RTF CAAAATTGAAAAATGGGGCTA rgg/mutR
SPD0939RTR GCAAGCTGAGAGACAATCTGC
SPD1463RTF ACTCATTGTAACCAGCGAAGGAGCA psaA
SPD1463RTR CCCAGATGTAGGCACTTGGAACACC
SPD1464RTF AGAATTGGCTGGACTGGACAA tpxD
SPD1464RTR CACCGCACCAACGTTTTTG
SPD1499RTF GGAGTGAGCCAATTTTTGC nanB
SPD1499RTR GCAGGCATAACATCAGCT
SPD1504RTF AGCAACCTCTGGCAAATGAA nanA
SPD1504RTR ATAGTAATCTCTTGGAATT
SPD1634F TCTCGGTGCTCGTATGACAG galK
SPD1634R CACCTGCAACTTCAGCGATA
SPD1652RTF CTTTGGTGCCAAATCTCGTT piuA
SPD1652RTR GCAAGGGTACGGTTGATGAC
MP 127 CCGGGGACTTATCAGCCAACC pR412 specific
MP 128 TACTAGCGACGCCATCTATGTG