Skip to main content

Table 1 Primers used in qRT-PCR detection of genes related to sulfur oxidation

From: Whole-genome sequencing reveals novel insights into sulfur oxidation in the extremophile Acidithiobacillus thiooxidans

Primer Sequence (5′ to 3′) Product size/bp Anneal temp./°C
Name Orientation    
sqr Forward GCTCGGCAGCCTCAATAC 136 56
  Reverse GGTCGGACGGTGGTTACTG   
sor Forward AAGCCCGTGCCTAAAGTG 266 56
  Reverse CTGCCATAGTTGGTGTTGT   
doxD Forward CATCCCAGGACTCCACAA 223 56
  Reverse GTCGCCACCTATTCTTACTATC   
tetH Forward TGAAAGACACGCTACCCG 270 56
  Reverse GGCCGCTCAATGATAACC   
hdrA Forward CCGATTTGAAGGTGAAGC 185 56
  Reverse CGGTTGCGACCATCTGTT   
hdrB Forward GTGGACCAGCGGGAAGAA 126 56.5
  Reverse TACCACGGCTCTGGCATCG   
hdrC Forward TATTGAGTTTGGTCGCATTG 114 55.5
  Reverse CCCTTGGACAGACGCTTT   
soxA-I Forward GCTCAGTCAGGGTAAGGC 161 56
  Reverse GACAACTATTCAAACGCATC   
soxB-I Forward GCGTATTACCGATTTGCG 198 56
  Reverse GGATTACCGGCCATGTTT   
soxX-I Forward GCAGGGTAATTGTTTGGC 163 56
  Reverse CATATTGATGTGCGGGAT   
soxY-I Forward GGAATGTCAGCAGTGGGTAT 203 56
  Reverse TTCTCCGCTATGGTTGGT   
soxZ-I Forward AAGCGGGCAAGTTGATTC 173 56
  Reverse CGTATTGTCTTTCCAGGTC   
soxA-II Forward ATCTTGATGCCGTTGCTG 164 56
  Reverse GCCCATTTCCCGACTTAT   
soxB-II Forward CCGTAAGGCATCACAGAG 244 56
  Reverse CAAGGTATTAGCCCGTTT   
soxX-II Forward CACAAATAGTCGGCAACCT 237 56
  Reverse CGCTCAGGGAAACTGTCTT   
soxY-II Forward TGATGCGTTGTTGGATGT 180 56
  Reverse CGCCCACTATTGCTGAAAA   
soxZ-II Forward AGGTAGGGATTGGCACTG 120 56.5
  Reverse CAAAGATAAGGCTGGAAAA   
rhd Forward GTGGTCCTGCTTACCCTCAA 130 56
  Reverse GCCCGATAATATCCTGCTACTG   
gapdh Forward TAGCCCAGAACGCCTTTG 141 56
  Reverse CGGTATGTCTTTCCGAGTG