Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: The Pseudomonas aeruginosa rhlG and rhlAB genes are inversely regulated and RhlG is not required for rhamnolipid synthesis

Name 5′-3′ sequencea Used for References
prRhlG1 attatgagctc CATCCTGTTCGTCCTGTTC (Sac I) cloning of rhlG promoter This study
prRhlG2 atattactagt GGGAGACCAGCCTACGAT (Spe I) cloning of rhlG promoter This study
rhlG33 GGATGCTGGCGAAGGAACT qRT-PCR This study
rhlG34 GTCATGCGGCTCGGAAAG qRT-PCR This study
16sFad1 CAGGATTAGATACCCTGGTAGTCCAC qRT-PCR [35]
16sRad2 GACTTAACCCAACATCTCACGACAC qRT-PCR [35]
rhlGko1 tatagaaTTC GTCGAGCACTACCTGTTG (Eco RI) Knock out This study
rhlGko2 tatactGCAG TTGCTGGATGCAGGA (Pst I) Knock out This study
rhlGko3 tatactgcaG CCTACATGACCGGCAAC (Pst I) Knock out This study
rhlGko4 atataagcTT GGTCGAGCCGCTGAT (Hin dIII) Knock out This study
PA3388ko1 tatagaaTTC ATCTGCGCACGTGAC (Eco RI) Knock out This study
PA3388ko2 tatatctAGA AACGCTGTGGGTCATG (Xba I) Knock out This study
PA3388ko3 ttattctaGA TATCAAGCCCTACGTACCCTAC (Xba I) Knock out This study
PA3388ko4 atttaagcTT CCGTGTACTGCATCTTTATCA (Hin dIII) Knock out This study
PA3388ko5 ttattctgcaG ATATCAAGCCCTACGTACCCTAC (PstI) Knock out This study
Gsp1G TGCGTCTTGAGTATTCTTCA 5′-RACE PCR This study
Gsp2G GCCCTACCGTATAGAGAAAA 5′-RACE PCR This study
NesG CCGTAATTCGTTATTTCCAT 5′-RACE PCR This study
  1. aCapital bases are complementary to the target sequence and italic sequences correspond to the restriction sites indicated in brackets.