Skip to main content

Table 1 Sequences of primers and probes utilized in the study

From: A novel, nested, multiplex, real-time PCR for detection of bacteria and fungi in blood

Amplification Oligonucleotide Sequence 5′ - 3′ Origin Target sequences
β-actin gene F GCCAGTGCCAGAAGAGCCAA [16] β-actin gene
  1. *External primers; **internal primers; k = G/T; r = A/G.