Skip to main content

Advertisement

Table 2 New and modified primers and probes used in this study

From: Multilocus sequence typing and ftsI sequencing: a powerful tool for surveillance of penicillin-binding protein 3-mediated beta-lactam resistance in nontypeable Haemophilus influenzae

Name Function Target Sequences (5′ to 3′)a Original (reference)
bexA Fb F-primer bexA CGTTTA TR TGATGTTGATCCT GA HI-1 [35]
bexA Rb R-primer bexA TGTCCATA TCTTCAAAATGG TG HI-2 [35]
bexA P Probe bexA FAM ATGCAAGYCGRGCTTTCATCCCTG-BHQ This study
Hinf_fR R-primer cap (serotype f) GG TACTATCAAGTCCAAATC f3 [35]
Hinf_eR2 R-primer cap (serotype e) CTAATTGTTCTTTCTGTCTA This study
ompP6 P Probe ompP6 ACG TGG TAC ACC AGA ATA CAA CAT CGA This study
H16SP Probe 16S rRNA gene TCGCTCCACCTCGCAGCTTCGCT This study
TEMP Probe bla TEM CAG CTC CGG TTC CCA ACG ATC AAG This study
ROBP Probe bla ROB TAG CGA CAA CAG CGC GAC CAA TTT G This study
  1. aSites of modifications in bold.