Skip to main content

Advertisement

Table 1 Primer sequence used to amplify all four fragments of M. pneumoniae M129 P1 gene

From: Delineation of immunodominant and cytadherence segment(s) of Mycoplasma pneumoniae P1 gene

Primers Position (bp) Sequences 5’ to 3’
F-P1-1 1–21 GGCCATGGGATCCATGCATCAAACCAAAAAAACG
R-P1-1 1051–1069 CCAAGCTTGTCGACCCAAGGAGTTGGTGATCC
F-P1-2 953–974 GGCCATGGGATCCATTAAACGGAGTGAAGAGTCA
R-P1-2 1978–1996 CCAAGCTTGTCGACGTTATTGTGAAAGTAGTA
F-P1-3 1875–1896 GGCCATGGGATCCTTACGCGAAGACCTGCAGCTC
R-P1-3 3840–3858 CCAAGCTTGTCGACCGGCTGGGTACTATGGTC
F-P1-4 3729–3749 GGCCATGGGATCCCTGCACTTGGTGAAACCGAA
R-P1-4 4878–4896 CCAAGCTTGTCGACTGCGGGTTTTTTGGGAGG
  1. The first letter of the primer name denotes the direction of the primer: F forward; R reverse.