Skip to main content

Table 3 Primers used in this study to target 16S r RNA genes of total archaea and the novel RCC species, mcrA genes of methanogens

From: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR

Target Primers Sequence (5’-3’) Annealing temp (°C) References
Archaea* 915f 1386r GTGCTCCCCCGCCAATTCCT GCGGTGTGTGCAAGGAGC 59 [11]
Methanogen 86f GCTCAGTAACACGTGG 56 [2]
1340r CGGTGTGTGCAAGGAG
The novel RCC species* 178f TGGGATCTGGAATGACCCATGG 56 This study
434r TGAGAAAAGCTAGAACAAATGTCCT
Methanogen 519f CAGCCGCCGCGGTAA 57 [39]
915r# CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCG
Methanogen (mcr A gene) MLf GGTGGTGTMGGATTCACACARTAYGCWACAGC 55 [40]
  MLr TTCATTGCRTAGTTWGGRTAGTT   
  1. *, For real-time PCR; , For DGGE; #, Where the primer name is prefaced by ‘GC-’ in the text, a GC-clamp was added to the 5’.
  2. -terminus of the primer. The GC-clamp sequence was CCCCGTGCTCCCCCGCCAATTCCT;.