Skip to main content

Table 2 Primers used in this study

From: L-alanine-induced germination in Bacillus licheniformis -the impact of native gerA sequences

Primer Sequence Application Amplicon size
A7F 5′- GGATTTGGGATACCGCTCTT -3′ gerA detection/sequencing 718 bp
A7R 5′- TGCAGATGCTGCGAGAATAC -3′ gerA detection/sequencing 718 bp
gerAAF MW3 5′- CCCTGTTCCTATCGGCGTTT -3′ RT-PCR (E = 2.01) 59 bp
gerAAR MW3 5′- TCGGCAGCATGCCTTGA -3′ RT-PCR (E = 2.01) 59 bp
gerAAF 1112/1032/800 5′- CGCCGTTCCCACAGATTC –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp
gerAAR 1112/1032/800 5′- CAGCGCTGAAGAAACCTTGTC –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp
rpoBR 5′- CCTCAATTGGCGATATGTCTTG -3′ RT-PCR (E = 2.00) 70 bp