Skip to main content

Table 1 Primer sets designed to detect goat pox and sheep pox virus by LAMP and universal LAMP primers designed for GTPV and SPPV

From: Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat Pox virus and Sheep Pox virus

Primers name Each set of primer Type Length Sequence(5’-3’) Notes
GSPV primers GSF3 Forward outer 22 AGCTGTTAGATCATTTCCAAAT The universal lamp primers for GTPV and SPPV, the predicted length of Lamp is 204 bp.
GSB3 Backward outer 23 CGTTCATTTTACAAGATGTCTTC
GSFIP Forward inner primer (F1c + F2) 44 CATCTAGGGAGGTTGCTGGAAAT
-GTGAGGCATCCTTTTTGAAAG
GSBIP Backward inner primer (B1 + B2c) 43 ATCAGAGATGGCTGTTGTGATATC
-CAGCAACTATGTCTACCGA
GTPV primers GF3 Forward outer 24 ACCAAAACAAATAATCAGAGATG The special lamp primers for GTPV, the predicted length of Lamp is 245 bp. The underlined sequences match specifically for GTPV genome but not SPPV genome.
GB3 Backward outer 23 CCTAATCCATTTAAGACACTACG
GFIP Forward inner primer (F1c + F2) 43 AAGATGTCTTCCGGTAACTATGTCT
-GCGGTTGTGATATCGTCA
GBIP Backward inner primer (B1 + B2c) 45 CCGAACTTGTTATTTCTTGTGCTT
-CACAATAAGGAACCACCTAGA
SPPV primers SF3 Forward outer 20 TGAGGCATCCTTTTTGAAAG The special lamp primers for SPPV, the predicted length of Lamp is 215 bp. The underlined sequence match specifically for SPPV genome but not GTPV genome.
SB3 Backward outer 22 AAGAAATAACAAGTTCGGGTTA
SFIP Forward inner primer (F1c + F2) 44 GCCATCTCTGATTATTTGTTTTGGT
-AACACATTTCCAGCAACCT
SBIP Backward inner primer (B1 + B2c) 45 CATCTGAAAAGTTGTTTCGGTAGAC
     -AGAGACTTTTATCCCGTTCA