Skip to main content

Table 3 Oligonucleotide primers used for PCR

From: The role of short-chain dehydrogenase/oxidoreductase, induced by salt stress, on host interaction of B. pseudomallei

Primer names Oligo sequences (from 5′–3′) Purpose Reference
BPSS2242-F1 ACCGCGCGACCGATATGAACG Forward primer for upstream fragment of SDO gene This study
BPSS2242-F2 GGACTCCTTGCCGAACGGGC Reverse primer for upstream fragment of SDO gene This study
BPSS2242-R1 GCCCGTTCGGCAAGGAGTCC AACGTCGAGGCGAAGCTGCC Forward primer for downstream fragment of SDO gene This study
BPSS2242-R2 TCCCTTCGCGCTCGTGCAAC Reverse primer for downstream fragment of SDO gene This study
OriT-F CAGCCTCGCAGAGCAGGATTC Forward primer for oriT [50]
OriT-R TCCGCTGCATAACCCTGCTTC Reverse primer for oriT [50]