Skip to main content

Table 2 Oligonucleotide primer sequences

From: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments

Primers Description Reference or source
Pbla 5′-CAGGGTTATTGTCTCATGAGCG-3′ [12]
Pdap 5′-CCGCCTCTACCAGCGTCTTGCC-3 [12]
DapB1 5′- GCATGAGAGCTCACCCTTTCCGTCAAAGTGC -3′ This Study
DapB2 5′- AAACCAGCGGCCGCTATACGTCGCATGCCGACTCC -3′ This Study
DapB3 5′- CGTATAGCGGCCGCTGGTTTGTACGACATGCAGG -3 This Study
DapB4 5′- TTACATGTCGACTTGCTCGCTACCAGCGG -3′ This Study
fFr2 5′- GTAACTGTTGGCCTGGAA -3′ This Study
rFr2 5′- GCCAAACGCGATCACA -3′ This Study
fFr4 5′- CCGCGTTATTCGCAGA -3′ This Study
rFr4 5′- TGTAATCATCCGGCCAGA -3′ This Study
fFr9 5′- GAGCCGACTGCACGAA -3′ This Study
rFr9 5′- TGGTCATGAGTTCGCTGA -3′ This Study
fFr10 5′- CGCACGTTCAGGCTGA -3′ This Study
rFr10 5′- CCAACAGCCACGAGCA -3′ This Study
fFr2com 5′- ATTGCGGCCGCTCAGGCTTCGGTCAGATACC-3′ This Study
rFr2com 5′- CGCACTAGTCGATGAAATTCGCAGCCATTGA -3′ This Study
fFr10com 5′- GCGCAATTCTTACTCTTTGTCCAGCATGCCA -3′ This Study
rFr10com 5′- ATTGCGGCCGCTATGAGCACTAGCGCAGCACA -3′ This Study