Skip to main content

Table 2 Primers used in this study

From: A new simple method for introducing an unmarked mutation into a large gene of non-competent Gram-negative bacteria by FLP/FRT recombination

Primer Sequence (5′ → 3′)
FRT-leftF AATCCATCTTGTTCAATCATGC
FRT-rightR AATTCGAGCTCGGGAAGATC
FRT-T7F AAATTAATACGACTCACTATAGG
FRT-SP6R TACGATTTAGGTGACACTATAG
Inv-pUC118F CAACGTCGTGACTGGGAAAAC
Inv-pUC118R TCATGGTCATAGCTGTTTCCTG
TetR-FLP2F CGATGGGTGGTTAACTCGAC
TetR-FLP2R ACAGGACGGGTGTGGTCG
AtaAupstF CGCGGATCC GATCTTCAAAGGTTGTGCTCAG
AtaAupstF2 AACGCAAGTTGTTTTACTGC
AtaAupstR CGCGGATCC TAGAAGCTGTAGCAGTTGTTCC
AtaAdwstF CGCGGATCC ACTCGACAGGGAAGATCTTC
AtaAdwstR CGCGGATCC AATTGAATCATCAACACCTGCTG
AtaAdwstR2 TACGTCGAGCAGCTAAGGTC
  1. Underlines indicate Bam HI site.