Skip to main content

Advertisement

Table 3 Primers used in this study

From: Two RND proteins involved in heavy metal efflux in Caulobacter crescentus belong to separate clusters within proteobacteria

Nome     Sequence (5- → 3)a
RND1 GGAATTCGCGATTGGCTAACGG
RND2 CAAGCTTGACCAACGCAACCAAG
RND3 GGAATTCGCCATCTGCGCCAACGATT
RND4 CAAGCTTCTCATGAAGCCTAGAG
RND5 GGGATCCGCCGGATCCCTCCGATGTGAAGAGG
RND6 CCTGCAGCGGACGCCGGCCTCTGCAGCCGC
RND7 CAAGCTTCATCCTCACCCTGAGACAA
RND8 GGAATTCAGAGATCCAAGATCCTG
RND9 GGAATTCGATCTGCCGGTTCGTCCTG
RND10 CGACGCGTTAGCCTCTTTCAATGTGAAGAC
RND11 CAAGCTTCTACCAAGGGCGGTCGCAT
RND12 GGGATCCTGGTCGCCTCCCTAATGGT
RND13 GGGATCCCATTGAGCCTCCGCCAGCT
RND14 CGACGCGTCTATAGTACCATCGCAATAC
RND15 GACTAGTATGATCGGCAGGATCTTGGAT
RND16 GACTAGTTTAGGCTCCTTGCTCTTGA
RND17 GGAATTCATGCTTGAACGCATCATCGCC
RND18 GACTAGTCTATCGTACCGCCCTGGCTTG
  1. a Boldface letters indicate restriction enzyme recognition sites, used for cloning purposes.