Skip to main content

Table 2 Universal bacterial primers and group-specific primers (based on 16S rRNA) and fungal primers (based on 18S rRNA) used for PCR amplification of L. sidoides stem and leaf DNA for DGGE evaluation

From: Does the essential oil of Lippia sidoidesCham. (pepper-rosmarin) affect its endophytic microbial community?

Communities Primers Reference         Sequences a
Total bacteria *U968/L1401 [26] *5′ACCGCGAAGAACCTTAC3′/
Total bacteria 799F/1492R [29] 5′AACMGGATTAGATACCCKG3′/
Alphaproteobacteria F203α/L1401 [30] 5′CCGCATACGCCCTACGGGGGAAAGATTTAT3′
*U968/L1401 [26]
Betaproteobacteria F948β/L1401 [30] 5′CGCACAAGCGGTGGATGA3′
*U968/L1401 [26]
Actinobacteria F243/L1401 [27] 5′ GGATGAGCCCGCGGCCTA 3′
*U968/L1401 [26]
  1. a The sequences correspond to the primers in bold.
  2. * Primer with a 40 bp GC-clamp (5- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG –3) attached.