Skip to main content

Table 1 Primers targeting some metal-resistance genes used in this study

From: Assessing the resistance and bioremediation ability of selected bacterial and protozoan species to heavy metals in metal-rich industrial wastewater

Primer name Mechanism involved/metal involved Sequence forward (5’-3’) Sequence reverse (5’-3’) Annealing temperature Amplicon size (bp)
chrB CHR transporter (efflux/reduction)/Cr GTCGTTAGCTTGCCAACATC CGGAAAGCAAGATGTCGATCG 57 450
czcD Cation diffusion facilitator (efflux)/Co, Zn and Cd TTTAGATCTTTTACCACCATGGG
57 1000