Skip to main content

Advertisement

Table 3 PCR primer pairs used for targeting invA gene for detection of Salmonella

From: Development of a sensitive and specific qPCR assay in conjunction with propidium monoazide for enhanced detection of live Salmonellaspp. in food

Primer sequence (5′---3′) Type of PCR Position Length (bp) Reference (year)
GCTGCGCGCGAACGGCGAAG Conventional 586-608 389 Ferretti et al. (2001)
TCCCGGCAGAGTTCCCAT T   972-954   
ACAGTGCTCGTTTACGACCT AAT Conventional 104-127 244 Chiu and Ou (1996)
AGACGACTGGTACTGATCGATAAT   347-324   
GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Malorny and Hoorfar (2005)
TCATCGCACCGTCAAAGGAACC   655-634   
GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Rahn et al. (1992) [28]
TCATCGCACCGTCAAAGGAACC6   655-634   
AGTGCTCGTTTACGACCTGAA Conventional 106-126 229 Mainar-Jaime et. al. ( 2013) [29]
TGATCGATAATGCCAGACGA   334-315   
ACAGTGCTCGTTTACGACC Conventional 104-122 1614 Banihashemi et al. (2012) [31]
TACGCACGGAAACACGTTC   1717-1699   
TTTACGGTCTATTTTGATTTG Conventional 1350-1370 444 Arnold et al. (2004) [30]
ATATGCTCCACAAGGTTAATG   1703-1683   
TTATTGGCGATAGCCTGG Real-time 401-418 33 ABI, (1999)
CGGTGGGTTTTGTTG   433-419   
TTGGCGATAGCCTGGCGGTG Real-time 404-423 136 Braun et al. (2011) [35]
TGTTTACCGGGCATACCATCCAGAG   539-515   
TCGTCATTCCATTACCTACC Real-time 167-186 119 Hoorfar et al. (2000) [33]
AAACGTTGAAAAACTGAGGA   285-266   
GATTCTGGTACTAATGGTGATGATC Real-time 132-156 269 Liang et al. (2011) [34]
GCCAGGCTATCGCCAATAAC   419-400   
GTGAAATAATCGCCACGTTCGGGCAA Real-time 371-396 285 Chen et al. (2011) [32]
TCATCGCACCGTCAAAGGAACC   655-634   
CGTTTCCTGCGGTACTGTTAATT Real-time 281-303 130 This study
TCGCCAATAACGAATTGCCCGAAC   410-387