Skip to main content

Advertisement

Table 6 List of primers used in this study for PCR amplification and sequencing of the four CRISPR-MVLST markers

From: CRISPR-MVLST subtyping of Salmonella enterica subsp. entericaserovars Typhimurium and Heidelberg and application in identifying outbreak isolates

Primer Orientation Primer sequence (5′-3′) Annealing temp. PCR Sequencing
CRISPR1-5 Forward TGAAAACAGACGTATTCCGGTAGATT 55.5
CRISPR1-1 Reverse CAGCATATTGACAAGGCGCT
CRISPR2-3 Forward ATTGTTGCGATTATGTTGGT 57
CRISPR2-1 Reverse TCCAGCTCCCTTATGATTTT  
CRISPR2-4 Reverse GCAATACCCTGATCCTTAACGCCA   
CRISPR2-5 Reverse CGACGAAATTAAAACCGAACT   
CRISPR2-6 Forward CGGATTCCATGCGTTTTCA   
CRISPR2-7 Forward CCGGCGAGGTCAATAAAA   
CRISPR2-8 Forward TGACGCTGGTCTATACCG   
CRISPR2-9 Forward GTGACGTCAGTGCCGAA   
CRISPR2-10 Reverse CTCTTCGCACTCTCGATCAA   
fimH-1 Forward AGGTGAACTGTTCATCCAGTGG 56.7
fimH-2 Reverse GCGGGCTGAACAAAACACAA
sseL-1 Forward AAAATCAGGTCTATGCCTGATTTAATATATC 60  
sseL-2 Reverse GGCTCTAAGTACTCACCATTACT  
sseL-3 Forward ACCAGGAAACAGAGCAAAATGAATATATGT   
sseL-4 Forward TTCTCTCGGTAAACTATCCTATTGGGC