Skip to main content

Table 2 Primers used in this study

From: Carbapenem-resistant Acinetobacter baumannii from Brazil: role of carO alleles expression and blaOXA-23 gene

Primers for PCR and sequencing
Primer name Primer sequence (5′ → 3′) Target gene
OXA SET B F ACAGAARTATTTAAGTGGG blaOXA-51-like and blaOXA-58-like alleles
ISABA1 F2b AGTTGCACTTGGTCGAATGA Detection of ISAba1 upstream blaOXA-51 and blaOXA-23
CARO F GCTCACCTGATGCTGACATT carO gene and its promoter
Primers for relative quantification
TR CARO F AGCTTTACTTGCTGCTGGTG A. baumannii carO transcription
TR CPN60 F TTGACCGTGGTTATATCTCTCC A. baumannii cpn60 transcription
  1. a Used in combination to amplify the blaOXA-143 allele.
  2. bused in combination with OXA SET B R and with OXA-23 R primers.