Skip to main content

Table 3 List of primers used for PCR amplification of protein-encoding genes from Treponema denticola strains

From: Multilocus sequence analysis of Treponema denticolastrains of diverse origin

Gene Primer Sequence(5to 3) Strains amplified
dnaN dnaNF ATGAAAATAAGTTTTGACAGAGACAC dnaF + dnaR: all strains (55-50°C)
  dnaNR TTACTCCGTCTGCATAGGC  
recA recAF1 GTGGCAAAAGCAAAAAAC recAF1 + recAR1: most strains (55-47°C)
  recAR1 TTAAAAAAGACTGTCGTCCG recAF2 + recAR2: ATCC 700768, MS25 (54-47°C)
  recAF2 TTCATATTGGCCGCATTTG recAF1 + recArecAR2: ATCC 700771 (55-49°C)
  recAR2 TTGTGTACTCATAATGCCGCTC  
  recAF GTGGCAAAAGCAAAAAACGAAG recAF + recAR: OMZ852, OMZ853, NY531, NY553 (58-53°C)
  recAR TTAAAAAAGACTGTCGTCCGCC  
radC radCF1 ATGATAGACTATAAAAATTCGTCCAATAC radCF1 + radCR1: most strains (55-50°C)
  radCR1 TTAAATATCAAACCTCGTTCCG radCF1 + radCR2: MS25 (55-49°C)
  radCF2 AACATGGCTTTCCGAAATC radCF2 + radCR1: ATCC 700768 (55-49°C)
  radCR2 GTGCAGCGGCTCTAAAAG  
ppnK TDE1591F1 ATATGGATCCCATATGAAAAAAG TDE1591F1 + TDE1591R1: most strains (52-45°C)
  TDE1591R1 AATTCTCGAGTCAATTCAGTTTGGG TDE1591F2 + TDE1591R2: OKA3, MS25,GM1, ST10A,
  TDE1591F2 AGCTACCCTGCCCTAATTTC ATCC 700768, ATCC 700771 (57-52°C)
  TDE1591R2 AACATCCTTAAAAAGCGGC  
flaA TDE1712F ATGAAAAAAACATTTATACTTGTTG TDE1712F + TDE1712R: all strains (52-46°C)
  TDE1712R TTATTGTTGGTTCTTTTCGG  
era eraF1 ATGAACAGCGGAGTTGTAAC eraF1 + eraR1: most strains (55-50°C)
  eraR1 TTAATACGAGATTTTTTTTATGATATTATC  
  eraF2 GGTACTTGTGCTTACCGAAAAC eraF2 + eraR2: MS25 (54-47°C)
  eraR2 CCGACACAATCGAGGAAG  
  eraF4 CGCTTAGAAGAAGGGGATGC eraF4, eraR4 separately used for direct chromosome sequencing of ATCC 700768
  eraR4 CTTTTTCGACATAGAGGAAGGC  
pyrH pyrHF ATGGTAACTGTTTTGTCGGT pyrHF + pyrHR: all strains (54-47°C)
  pyrHR TTAGCCGATTACCGTTCCTT  
  1. Genetic loci are based on the ATCC 35405 type strain of Treponema denticola.
  2. F: Forward primer; R: Reverse primer. Values in parenthesis indicate annealing temperatures used in ‘touchdown PCR’ procedures.
  3. PCR amplification was unsuccessful; sequencing of chromosomal DNA employed.