Skip to main content

Table 1 The genes analyzed in this study and the sequences of the qPCR primer sets

From: Enterohepatic bacterial infections dysregulate the FGF15-FGFR4 endocrine axis

Gene Official symbol Product Primers
Abcg5 Abcg5 ATP-binding cassette, sub-family G (WHITE), member 5 TGTCAACAGTATAGTGGCTCTG
Abcg8 Abcg8 ATP-binding cassette, sub-family G (WHITE), member 8 CTTGTCCTCGCTATAGCAACC
Asbt Slc10a2 Apical sodium-dependent bile acid transporter ACCTTCCCACTCATCTATACTG
Bsep Abcb11 Bile salt export pump CAACGCATTGCTATTGCTCGG
Cyp7a1 Cyp7a1 Cholesterol 7 alpha hydroxylase GGGAATGCCATTTACTTGGATC
Fabp6 Fabp6 Fatty acid binding protein 6 GAATTACGATGAGTTCATGAAGC
Fgf15 Fgf15 Fibroblast growth factor 15 AGACGATTGCCATCAAGGACG
FgfR4 Fgfr4 Fibroblast growth factor receptor 4 CTCGATCCGCTTTGGGAATTC
FXR Nr1h4 Farnesoid X receptor (nuclear receptor subfamily 1, group H, member 4) GTTCGGCGGAGATTTTCAATAAG
Mdr1a Abcb1a ATP-binding cassette, sub-family B member 1a CCGATAAAAGAGCCATGTTTGC
Mdr1b Abcb1b ATP-binding cassette sub-family B member 1b GGACCCAACAGTACTCTGATC
Mdr2 Abcb4 Multidrug resistance protein 2 TTGTCAATGCTAAATCCAGGAAG
Mrp2 Abcc2 ATP-binding cassette, sub-family C (CFTR/MRP) member 2 GGCTCATCTCAAATCCTTTGTG
Mrp3 Abcc3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 GAACACGTTCGTGAGCAGCC
Mrp4 Abcc4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 TACAAGATGGTTCAGCAACTGG
Ntcp Slc10a1 Sodium-taurocholate co-transporting polypeptide CGTCATGACACCACACTTACTG
Osta Osta Organic solute transporter alpha TCTCCATCTTGGCTAACAGTG
Ostb Ostb Organic solute transporter beta CCACAGTGCAGAGAAAGCTGC
Shp Nr0b2 Small heterodimer partner AGTCTTTCTGGAGCCTTGAGC
SrbI Scarb1 Scavenger receptor class B type 1 GAACTGTTCTGTGAAGATGCAG
36B4 Rplp0 Ribosomal protein, large, P0 TCTGGAGGGTGTCCGCAAC
  1. The top sequence of each set corresponds to the forward primer and the bottom one to the reverse. All reactions were done in 10 μl final volume with 40 cycles of 30 seconds denaturing at 95°C, 30 seconds annealing at 60°C and 30 seconds extension at 72°C (except annealing temperature for Ostβ, which was 62°C).