Skip to main content

Table 1 Strains, plasmids and oligonucleotides used in this study

From: The SseC translocon component in Salmonella enterica serovar Typhimurium is chaperoned by SscA

Strains, plasmids and primers Description Reference or source
Strains   
SL1344 Salmonella enterica serovar Typhimurium wild type Our collection
sscA SL1344, deletion of sscA This study
sseC SL1344, deletion of sseC This study
SL1344 RES SL1344, ushA::Cm; CmR (10 μg/ml) [29]
Plasmids   
pKD4 oriRγ, KanR cassette flanked by FRT sites [26]
pKD46 RepA1019(Ts), λ, γ, β and exo expressed from ParaBAD, AmpR [26]
pFLAG-CTC Cytoplasmic expression of C-terminal FLAG fusion protein under control of the Ptac, AmpR Sigma
psscA-FLAG pFLAG-CTC, expresses in-frame fusion of SscA-FLAG This study
psseC-FLAG pFLAG-CTC, expresses in-frame fusion of SseC-FLAG This study
pACYC184 General cloning, TetR, CmR Our collection
psscA-6His pACYC; expresses in-frame fusion of SscA-6His This study
pBAD24 Arabinose-inducible gene expression, pBR322ori, PBAD, rrnBT1,2, araC, AmpR [27]
psscA sseA-sscA with endogenous sseA promoter in pWSK29, pSC101ori, AmpR This study
Primers   
sseC lambda-F cgaattcacagtaatagcgacagcgccgcaggagtaaccgccttaacacagtgtaggctggagctgcttcg  
sseC lambda-R gcgatagccagctattctcgcctgaacgctactatagtgatcaatggtatcatatgaatatcctcctta  
sscA lambda-F gacccgaccctacaacaggcacatgacacgatgcggtttttccggcgtgggtgtaggctggagctgcttcg  
sscA lambda-R gtcagaaagttgctgtaacatcttttctgcacgctgtcggagaatttgatcatatgaatatcctcctta  
sscA-FLAG-F gcttaaagcttatgaaaaaagacccgaccct  
sscA-FLAG-R tatctgtcgacgctcctgtcagaaagttgct  
sseC-FLAG-F ggtcacatatgatgaatcgaattcacagtaa  
sseC-FLAG-R ggtcagtcgacagcgcgatagccagctattc  
sscA-HIS-F gtcaggctagcaggaggatgcatcaccatcaccatcacatgaaaaaagacccgaccc  
sscA-HIS-R gtcagaagcttttagctcctgtcagaaagttg  
sscA-F acgcgtcgacacaggatccgcagcaatatc  
sscA-R gctctagacccctaaatatgcaggctca