Skip to main content

Table 6 Primers used in polymerase chain reaction analysis

From: Diffusely adherent Escherichia colistrains isolated from children and adults constitute two different populations

Gene Locus description Primer sequence Fragment length Annealing temperature Reference
afa B-C Conserved region of Afa/Dr operons 5´ CTGGGCAGCAAACTGATAACTCTC 3´ 750 pb 62°C [75]
5´ CATCAAGCTGTTTGTTCGTCCGCCG 3´
afaE -1 Afa-I afimbrial adhesin 5´ CGAAAACGGCACTGACAAG 3´ 230 pb 61°C [19]
5´ AGGCTTCCGTGAATACAACC 3´
afaE -2 Afa-II afimbrial adhesin 5´ TTAGACCGTACTGTTGTGTTACC 3 375 pb 48°C [42]
5´ TTTCCCAGTAGACTGGAATGAAGC 3´    
afaE -3 /dre Afa-III afimbrial adhesin/Dr afimbrial adhesin 5´ TTAGACCGTACTGTTGTGTACC 3´ 408 pb 65°C [76]
5´ ACCATTGTCGGTCGTCCAGGC 3´
afaE -5 Afa-V afimbrial adhesin 5´ TTAGACCGTACTGTTGTGTTACC ´ 429 pb 48°C [42]
5´ AGCATCGGCGCGGTATACGGT 3´
daa E F1845 fimbrial adhesin 5´ TGACTGTGACCGAAGAGTGC 3´ 380 pb 48° [19]
5´ TTAGTTCGTCCAGTAACCCCC 3´
Sat Secreted auto transported toxin 5´ GCAGCAAATATTGATATATCA 3´ 630 pb 57°C [21]
5´ GTTGTTGACCTCAGCCAAGGAA 3´
escJ Type Three Secretion System 5´ CACTAAGCTCGATATATAGAACCC 3’ 826 pb 54°C [20]
5’ GTCAATGTTGATGTCGTATCTAAG 3’
escV Type Three Secretion System 5’ GATGACATCATGAATAAACTC 3’ 2130 pb 54°C [20]
5’ GCCTTCATATCTGGTAGAC 3’
traA Pilin 5’ AAGTGTTCAGGGTGCTTCTG 3’ 385 pb 60°C [28]
5’ TATTCTCGTCTCCCGACATC 3’
eae intimin 5’ CCCGAATTCGGCACAAGCATAAGC 3’ 881 pb 52°C [77]
   5’ CCCGGATCCGTCTCGCCAGTATTCG3’