Skip to main content

Table 2 Oligonucleotides used in this study

From: Deletion of the HAMP domains from the histidine kinase CaNik1p of Candida albicans or treatment with fungicides activates the MAP kinase Hog1p in S. cerevisiae transformants

Primer Sequence (5´-3´) Used in mutation of:
F2Gln CTAGCGAACATGTCGCAAGAGATACGTACACC HisKA domain
R2Gln GGTGTACGTATCTCTTGCGACATGTTCGCTAG
TAsnF CTTAACTTGGCTGGTGATGCTATTAAGTTTAC HATPase_c domain
TAsnR GTAAACTTAATAGCATCACCAGCCAAGTTAAG
AAsnF GATGTGGTGTTGATGAATGTGCAAATGCCTGTAATG REC domain
AAsnR CATTACAGGCATTTGCACATTCATCAACACCACATC
HMPF1 AGGGAATATT AAGCT TATGAACCCCACTAAAAAACCACG HAMP domains
HMPR1 GTTCGCGTTTTTGGATTTTTCTAG
HMPF2 TCCAAAAACGCGAACAGGAATACTGCGGCTAGAGAAGCTG
HMPR2 GCTCGGTACC AAGCT TTCAGTGGTGATGGTGATGATGTCC
  1. Bold bases are those used to introduce the point mutations. Bold italic bases indicate the HindIII restriction sites. Underlined bases are the overlapping sequences recognized by the in-fusion enzyme.