Skip to main content

Table 1 Sequence, expected amplicon sizes, and annealing temperature for the AcH 505 and P. croceum primers

From: Detection and quantification of a mycorrhization helper bacterium and a mycorrhizal fungus in plant-soil microcosms at different levels of complexity

Target Amplicon size (bp) Primer sequence (5′ → 3′) Annealing temp. (°C)
AcH 505, intergenic region between gyrA/gyrB genes 107 AcH107-f (GGCAAGCAGAACGGTAAGCGG) 55
AcH107-r (TGGTCGGTGTCCATCGTGGT)
P. croceum, ITS 121 ITSP1-f (GGATTTGGAGCGTGCTGGCGT) 55
ITSP1-r (TTGTGAGCGGGCTTTTCGGACC)
P. croceum, intergenic region between two ORFs 127 Pilo127-f (GTCAGAGACGGACGCAGTTG) 62
   Pilo127-r (CCAGTCAGCGGAGGAGAA)