Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons

Mujahid, Sana; Orsi, Renato H; Boor, Kathryn J; Wiedmann, Martin

doi:10.1186/1471-2180-13-156

BMC Microbiology

Table 1 Proteins found to be differentially regulated by σ^H, as determined by a proteomic comparison between L. monocytogenes 10403S Δ BCL and Δ BCHL

From: Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons

Protein^a	Fold change Δ BCL/ΔBCHL	Description	Gene name	Role category^b	Sub-Role category^b	Promoter^d	Sigma factor
Proteins with positive fold change ( > 1.5) and p < 0.05 (indicating positive regulation by σ^H)
Lmo0027	1.55	beta-glucoside-specificPTS system IIABC component	lmo0027	Transport and binding proteins	Carbohydrates, organic alcohols, and acids	aggaca cgtgtatgcgtggagtcctcgaatga	SigmaH
				Amino acid biosynthesis	Aromatic amino acid family
				Energy metabolism	Pyruvate dehydrogenase
Lmo0096	3.39	mannose-specific PTS system IIAB component ManL	mptA	Energy metabolism	Pyruvate dehydrogenase	tggca cagaacttgca	SigmaL
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo0239	1.82	cysteinyl-tRNA synthetase	cysS	Protein synthesis	tRNA aminoacylation	ttgcaa ggaattttattgctgttataatag	SigmaA
Lmo0319	1.77	beta-glucosidase	bglA	Energy metabolism	Sugars	N/A	N/A
Lmo0356	2.16	YhhX family oxidoreductase	lmo0356	Energy metabolism	Fermentation	tggcta agtacagcgctagtgtagtactat	SigmaA
				Energy metabolism	Electron transport
				Central intermediary metabolism	Other
Lmo1001	1.65	hypothetical protein	lmo1001	Unclassified	Role category not yet assigned	N/A	N/A
Lmo1070	2.18	similar to B. subtilis YlaN protein	lmo1070	Hypothetical proteins	Conserved	ttgcgt ggcaaataaattatgctatact	SigmaA
Lmo1255	1.60	trehalose-specific PTS system IIBC component	lmo1255	Energy metabolism	Pyruvate dehydrogenase	ttgcgc tttcaactgatttatagtatagt	SigmaA
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo1439	1.66	superoxide dismutase	sodA	Cellular processes	Detoxification	ttgcaa gcatttagggagcatggtaggct	SigmaA
						gttt aacttttgagtttcagggaaa	SigmaB
Lmo1454^c	1.85	RNA polymerase sigma factor RpoD	rpoD	Transcription	Transcription factors	gtttt aaaaccgctaaatgatggtat	SigmaB
						aggact tttgctttttgtggcgaatat	SigmaH
						ttgact ttttagcaaaaatacagtatctt	SigmaA
Lmo2006	1.60	acetolactate synthase catabolic	alsS	Amino acid biosynthesis	Aspartate family	ttgcaa taattcttttgagtagtataat	SigmaA
				Amino acid biosynthesis	Pyruvate family
Lmo2064	2.01	large conductance mechanosensitive channel protein	mscL	Cellular processes	Adaptations to atypical conditions	tttcac atcgcagttagatgttttatact	SigmaA
Lmo2487	1.65	hypothetical protein	lmo2487	Hypothetical proteins	Conserved	N/A	N/A
Lmo2614	2.05	50S ribosomal protein L30	rpmD	Protein synthesis	Ribosomal proteins: synthesis and modification	ttgatt actacccctaacccgtgtataat	SigmaA
Lmo2621	1.63	50S ribosomal protein L24	rplX	Protein synthesis	Ribosomal proteins: synthesis and modification	ttgatt actacccctaacccgtgtataat	SigmaA
Proteins with negative fold change ( < -1.5) and p < 0.05 (indicating negative regulation by σ^H)
Lmo1877	−1.61	formate-tetrahydrofolate ligase	fhs	Amino acid biosynthesis	Aspartate family
				Protein synthesis	tRNA aminoacylation
				Amino acid biosynthesis	Histidine family
				Purines, pyrimidines, nucleosides, and nucleotides	Purine ribonucleotide biosynthesis
				Biosynthesis of cofactors, prosthetic groups, and carriers	Pantothenate and coenzyme A
Lmo2094	−7.35	hypothetical protein	lmo2094	Energy metabolism	Sugars
Lmo2097	−3.17	galactitol-specific PTS system IIB component	lmo2097	Energy metabolism	Pyruvate dehydrogenase
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo2098	−2.33	galactitol-specific PTS system IIA component	lmo2098	Energy metabolism	Pyruvate dehydrogenase
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids

^aProtein names are based on the L. monocytogenes EGD-e locus.
^bRole Categories and Sub-Role categories are based on JCVI classification [26].
^cReported as positively and directly regulated by σ^H in Chaturongakul et al., 2011 [7].
^dPromoters were identified based on RNA-Seq data (Orsi et al., unpublished) or previously published data. -10 and -35 (σ^A, σ^B, σ^H) and -12 and -24 (σ^L) regions are underlined. N/A indicates that a promoter was not identified.

Back to article page

ISSN: 1471-2180

Contact us

General enquiries: journalsubmissions@springernature.com