Skip to main content

Table 2 Primers and probes used in this study for the detection and quantification of Pseudomonas aeruginosa

From: Proposal of a quantitative PCR-based protocol for an optimal Pseudomonas aeruginosa detection in patients with cystic fibrosis

Name Sequence (5′- 3′)* DNA target Reference
OPRL-F AACAGCGGTGCCGTTGAC oprL [30]
OPRL-R GTCGGAGCTGTCGTACTCGAA oprL [30]
oprL-MGB fam -TGAGCGACGAAGCC-bhq oprL [30]
gyrB-F CCTGACCATCCGTCGCCACAAC gyrB [19, 36]
gyrB-F CGCAGCAGGATGCCGACGCC gyrB [19, 36]
gyrB-TM fam-CCGTGGTGGTAGACCTGTTCCCAGACC-bhq gyrB [14]
ecfX-F CGCATGCCTATCAGGCGTT ecfX [14]
ecfX-R GAACTGCCCAGGTGCTTGC ecfX [14]
ecfX-TM yak-ATGGCGAGTTGCTGCGCTTCCT-bhq ecfX [14]
  1. *yak = Yakima Yellow; fam = carboxyfluorescein; bhq = block hole quencher.