Skip to main content

Table 1 Primers used for detection of TEM, SHV and Carbapenemase genes

From: Community acquisition of β-lactamase producing Enterobacteriaceae in neonatal gut

Primers Primer Sequence (5′ to 3′ direction) Annealing Amplicon size
   Temperature (°C) (bp)
TEM FP- ATG AGT ATT CAA CAT TTC CG 50 858
  RP- CCA ATG CTT AAT CAG TGA GG   
SHV FP- ATG CGT TAT ATT CGC CTG TG 58 862
  RP- AGC GTT GCC AGT GCT CGA TC   
KPC-1 FP- AGC CGT TAC AGC CTC TGG AG 55 1351
  RP- GAT GGG ATT GCG TCA GTT CAG   
KPC-2 FP- CAC TGT ATC GCC GTC TAG TTC 55 812
  RP- TGT GCT TGT CAT CCT TGT TAG   
NDM-1 FP- CGACGATTGGCCAGCAAATG 58 551
  RP- ACTTGGCCTTGCTGTCCTTG   
IMP FP- TTGAAAAGCTTGATGAAGGCG 58 616
  RP- ACCGCCTGCTCTAATGTAAG   
VIM FP- TTGACCGCGTCTATCATGGC 58 762