Skip to main content

Table 6 Primers used in this study

From: Adaptive mechanisms of Campylobacter jejunito erythromycin treatment

Primers Sequence*(5’ → 3’) (restriction enzyme)
Primers for mutant construction  
cj0308c-F(AF) CTCGAATTCCCTTTTCCATAGATGTTTGC (EcoRI)
cj0309c-R (AR) CCAGGTACCAAATTTCACAGGCAGTAGCT(KpnI)
cj0310c-F (BF) GAATCTAGAGTGGGGTAATGATAGGAGTG(XbaI)
cj0311-R (BR) CCAGTCGACCAAGGGCTAAAAGATTGATA (SalI)
cj0422c-F (CF) GCCGAATTCAATAAGGGTTGTAATTGAAGCG (EcoRI)
cj0423-R (CR) AATGGTACCTGCTCAAACCAATAATAGCG(KpnI)
cj0425-F (DF) TTTGCTAGCGGACTA TTATTGTTTGGCTTGT (NheI)
cj0426-R (DR) ATCCTGCAGGTCTAATGAGTTGGCCTGAA (PstI)
cj1168c-F(EF) AGCGAATTCACAGAACCTAAAGTCCCA (EcoRI)
cj1169c-R (ER) AATCGGTACCATCCAGAGCCAGAGTCAAA(KpnI)
cj1170c-F (FF) AAATCTAGAATGAAAGAAGACAAGCACT(XbaI)
cj1171c-R (FR) TTGGCATGCTAGAAACTGAAAAAGGCAC (SphI)
cj1172c-F (GF) ACAGAATTCACGGTGCGTGTAGGGTT (EcoRI)
cj1173-R (GR) ACTGGTACCACAATAGCAGCAATCAAGAA(KpnI)
cj1174-F (HF) GGTTCTAGAGGCATCATAGGAACTTGTCT(XbaI)
cj1175c-R (HR) GGTCTGCAGATCGATGATGTAATGAAAGC (PstI)
16S-F ATCGTAGATCAGCCATGCTA
Primers for complementation construction  
cj1169c-cj1170c-F TTGTCTAGAAAAAGATTAAACAGTAA(XbaI)
cj1169c-cj1170c-R AACTCTAGAACAAGGAGTTATGATTA(XbaI)
cj1173-cj1174-F TATTCTAGACAGTGCCACCTTCTTTAGCG(XbaI)
cj1173-cj1174-R CCGTCTAGACTTTAATGGGTATTGAAGCA(XbaI)
Primers for qRT-PCR  
qRT-16S-F TCCCAGTTCGGATTGTTCTC
qRT-16S-R GTACAAGACCCGGGAACGTA
cj0061-F GAAGGCAAGCGTTCTTTTAGTCT
cj0061-R AGAAAGAGCAAGATGAGCTTGTG
cj0258-F GTGAAAATGCCGATGAAAATG
cj0258-R GCGATGATGGTAGGTTTACTTTG
cj0310c-F TAGAGTGCTTTTGGGTAAGTGGA
cj0310c-R AATACAAACCCCAATGGCTGTTA
cj0345-F TATGGTGTTGTTTTGGGTTCTTC
cj0345-R CCAGCAATAGGGGCTAAATAAAT
cj0425-F CTTCAGGCCAACTCATTAGA
cj0425-R GGGCTTTAAGTCCGGATAATTC
cj0426-F AACCTTGATTTAGAGGCGATTTC
cj0426-R GCCTATCATGAGAGATGACAACC
cj0767-F ATGGTTTCCATATCTTCCCAAAG
cj0767-R TAATCCGTGGACTTAGAGCAGTG
cj1168c-F CAAGTATAGCCACCCAAATAGCA
cj1168c-R TTACCAGGGATTCGTCAGTACAT
cj1170-F CAAAATCAGTCATATGAGCCACA
cj1170-R CTATGCTGCAGTAGAAGGAGAGC
cj1173-F CTGTATGGGAGCTTTTAGGGATT
cj1173-R TCCAACGATAGAAAGAACAATGC
cj1226-F GCTTTGCTTCTGTTATCTCATCC
cj1226-R AGGCTCTTAAATTTTGCAGGAGT
cj1563-F GCAGTTTTTATACCCAAAGAGCA
cj1563-R GCGATATAGAATGGGTAAAATGG
Primers for conventional RT-PCR
cj0423-F GCGGGTCTATTTTTGTA
cj0425-R CTTGGCTATTTCCTTGA
  1. *Underlined sequences indicate recognition site for the corresponding restriction endonuclease, which is shown in parenthesis.