Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences used in this study for PCR and PCR-DGGE. The accession numbers point to the genes that were used to construct the gene specific primers.

From: Microbial community of predatory bugs of the genus Macrolophus(Hemiptera: Miridae)

Targeted gene Name Sequence Accession number/ Reference
Cytochrome b gene of Macrolophus spp. CB-1 5’- TATGTACTACCATGAGGACAAATATC -3’ [68]
General primers for the bacterial 16S rRNA gene 27F 5’- AGAGTTTGATCMTGGCTCAG -3’ [43]
  1525R 5’- AAAGGAGGTGWTCCARC -3’ [69]
V3 region of the bacterial 16S rRNA gene* 338FGC 5’- CGCCCGCCGCGCGCGGC [43]
  518R 5’- ATTACCGCGGCTGCTGG -3’ [30]
wsp gene of Wolbachia wsp81F 5’- TGGTCCAATAAGTGATGAAGAAAC -3' [70]
  wsp691R 5’- AAAAATTAAACGCTACTCCA -3’ [70]
16S rRNA gene of R. limoniae and R. bellii Rick-1F 5’- ATACCGAGTGRGTGAYGAAG -3’ AF322442, L36103
16S rRNA gene of R. limoniae Ricklimoniae-F 5’- CGGTACCTGACCAAGAAAGC -3’ AF322442
16S rRNA gene of R. bellii Rickbellii-R 5’- TCCACGTCGCCGTCTTGC -3’ L36103
Citrate synthase gene (gltA) gltA133f 5’- GGTTTTATGTCTACTGCTTCKTG -3’ [17]
  gltA1197r 5’- CATTTCTTTCCATTGTGCCATC- 3’ [17]
Cytochrome c oxidase gene (coxA) coxA322f 5’- GGTGCTCCTGATATGGCATT -3’ [18]
  coxA1413r 5’- CATATTCCAACCGGCAAAAG -3’ [18]
p-GEMT cloning vector T7 5’- TAATACGACTCACTATAGGG -3’ Promega
  1. *The sequence of the GC-clamp is indicated in bold