Skip to main content

Table 2 List of primers designed according to the wMel genome sequence to amplify VNTRs and ANK genes.

From: Tandem repeat markers as novel diagnostic tools for high resolution fingerprinting of Wolbachia

Locus/primer 5’ sequence Reference
VNTR-141 for ggagtattattgatatgcg [30]
VNTR-141 rev gactaaaggttagttgcat [30]
VNTR-105 for gcaattgaaaatgtggtgcc [30]
VNTR-105 rev atgacaccttacttaaccgtc [30]
RO550F ggccaccatgggatcagaatttgaag [82]
RO550R gatgacttatacgcagccccatag [82]
RO766F gaccaccatgaaatatgacaaattt [82]
RO766R tcaagtaagtgctttttctgtc [82]