Skip to main content

Advertisement

Table 1 Primers used in qRT-PCR

From: Wolbachia surface protein induces innate immune responses in mosquito cells

  Forward primer Reverse primer
An gambiae   
APL1 ACCAGCCGCAGTTTGATAG CAATCCCAGTCATTATGCGA
RpS7*, CEC1, DEF1 ref [21]and GAMB, TEP1, FBN9 ref [22]
Ae albopictus !   
DEF (D) * TTCGATGAACTACCGGAGGA AGCACAAGCACTGTCACCAA
RpL17* AGTGCGTTCCATTCCGTC CTTCAGCGTTCTTCAACAGC
CEC (A1), TEP (20), PGRP (SP1) and CLIP (B37) ref [23]
  1. *RpS7 was used as the reference gene in An. gambiae analysis while RpL17 was the reference for Ae. albopictus. !The Ae albopictus immune gene primers have been determined via degeneracy against the corresponding Ae. aegyptiorthologous genes shown in brackets.