Skip to main content

Table 2 Primer sets used for the 16S rRNA gene quantification of A. muciniphila , F. prausnitzii , Enterobacteriaceae , Clostridium cluster IV, Bifidobacterium and Lactobacillus group by qPCR. Amplicon size, annealing and fluorescence acquisition temperature are also reported

From: Unbalance of intestinal microbiota in atopic children

Target microorganism Primer set Sequence (5' to 3') Product size (bp) Annealing temp (°C) Fluorescence acquisition temp (°C) Reference
Akkermansia muciniphila AM1 CAGCACGTGAAGGTGGGGAC 349 63 88 [31]
Faecalibacterium prausnitzii Fprau223F GATGGCCTCGCGTCCGATTAG 199 67 85 [32]
Enterobacteriaceae Eco1457F CATTGACGTTACCCGCAGAAGAAG 195 63 87 [32]
Clostridium Cl_IV S-*-Clos-0561-a-S-17 TTACTGGGTGTAAAGGG 588 60 85 [33]
  S-*-Clept-1129.a-A-17 TAGAGTGCTCTTGCGTA     
Bifidobacterium bif-164 GGGTGGTAATGCCGGATG 523 60 90 [34]
Lactobacillus group Lac1 AGCAGTAGGGAATCTTCCA 327 61 85 [35]