Skip to main content

Table 2 Primers and probes tested in this study

From: Development and validation of a real-time PCR assay for detection and quantification of Tuber magnatum in soil

Primer/Probe Sequence (5′-3′) Length (bp) Amplicon (bp) Target region GC (%)
TmgITS1for GCGTCTCCGAATCCTGAATA 20 106 ITS1 50
TmgITS1rev ACAGTAGTTTTTGGGACTGTGC 22    45
TmgITS1prob TGTACCATGCCATGTTGCTT 20    45
TmgITS2for AAACCCACTCACGGAATCAC 20 99 ITS2 50
TmgITS2rev CGTCATCCTCCCAATGAAA 19    47
TmgITS2prob GTACCAAGCCACCTCCATCA 20    55