Skip to main content

Table 1 Primer sequences used in this study

From: Gene expression profiling of Mycobacterium avium subsp. paratuberculosis in simulated multi-stress conditions and within THP-1 cells reveals a new kind of interactive intramacrophage behaviour

Gene ID Primer name Primer sequence (5'-3')
rRNA 16s MAP 16S FW GCCGTAAACGGTGGGTACTA
  MAP 16S RV TGCATGTCAAACCCAGGTAA
MAP 3738c MAP 3738c FW CCCACATTGGGATATGAAGC
  MAP 3738c RV CTGAGGATCCTGGAGACGAG
MAP 3522 MAP 3522 FW CTACCGGGAGCGTTATGTGT
  MAP 3522 RV ACGATGGACGCCCAACTA
MAP 1643 MAP 1643 FW TGGAGCGAGAACTACCACCT
  MAP 1643 RV CACAGGTGGATCAACGTCAT
MAP 0654 MAP 0654 FW GCAGGACTACACCATCGTCAT
  MAP 0654 RV GTAGTCCTCCGTCGCCTTCT
MAP 1407 MAP 1407 FW CGCTGTACACCGGAAAGATT
  MAP 1407 RV CCGGTATTGGTAGACCATCG
MAP 1317c MAP 1317c FW CAGGTGGTATTCGCCTTCTC
  MAP 1317c RV ATGAACCCGATACCAATCCA
MAP 1535 MAP 1535 FW GTGTTCGTCTACGCGTTGCT
  MAP 1535 RV ACCATGTAGAGGCGGTCCAC
MAP 2055 MAP 2055 FW GAAATATCAATGGCCGCAAG
  MAP 2055 RV AAGTTCAGTCGCAGGTGTCC