Skip to main content

Table 4 Primers used in this study

From: A Fur-like protein PerR regulates two oxidative stress response related operons dpr and metQIN in Streptococcus suis

Primers Sequence Restriction site target
General PCR amplification
310 F CGTACAGTCGACTTAGTTCTGGCAATCAGGACA SalI perR
310R CGTATCGGATCCATGGAACTCCATTCTCACTTC BamHI  
310 L01: TAGTAAGCTTCACAGTTGGACCTTGGTT Hind III Left arm of perR
310 L02 TCACCTGCAGCGGCATTTGTCCTGATTG PstI  
310R01 TCACCTGCAGTTAGCATTGAAGTGAGAATGG PstI Right arm of perR
310R02 AGGTGAATTCTTGCTACTGTAATGGTCG EcoRI  
ermF TCACCTGCAGGAGTGTGTTGATAGTGCA PstI erm r
ermR AGGTCTGCAGCTTGGAAGCTGTCAGTAG PstI  
C310F TCACCTGCAGGATGATGTGGCTGTGTTG PstI perR and its promoter
C310R TAGTGGATCCAAGTCATGTCCGTCGTAG BamHI  
PdprF TCAGAATTCTCGGGCTATAGGTAAAAG EcoRI Promoter of dpr
PdprR TCAGGATCCATATCACCCTTTCTTTTATT BamHI  
EGFP 01 TCAGGATCCATGAGTAAAGGAGAAGAAC BamHI EGFP gene
EGFP 02 TCACTGCAGTGCTATTTGTATAGTTCATC PstI  
1772P01 TCCAGGACTGGTGGCGAC   Promoter of 1772
1772P02 AAAATGATCTCCTTAAATTA   
relAP01 CATATCTCTACTCTTCCTC   Promoter of relA
relAP02 AGCTAGTGTGAGTGCTAC   
gidAP01 CATGTTGTTCTCTCCTTC   Promoter of gidA
gidAP02 TTGAGGTCAATGAGGTAG   
Real-time RT-PCR   
0309 F GCAACACTTTCTGCCATCA   pmtA
0309R GGTCGCACCTACAACTTCA   
1771 F CGCACCAATCCGTCTTTA   metQ
1771R TTTCGTTTGTTGGGTCGT   
2094 F TAAGACCGACGAATCCC   relA
2094R TCATCCGCGACAGCT   
1689 F TTTATCAGTAGCCCATTCA   dpr
1689R AAACGCTCACTCATCTCA   
1539 F AGAAGGCAAGTTGGAAG   sodA
1539R GTAGTTTGGACGGACATT   
0155 F AGAAGTAAACGCTGCTAT   gapdh
0155R CAAACAATGAACCGAAT