Skip to main content

Advertisement

Table 2 PCR primers used in this study

From: Characterisation of a cell wall-anchored protein of Staphylococcus saprophyticus associated with linoleic acid resistance

Primer Sequence (5'-3') Description
1127 GTTGAAGCAATATTGAAGAAAGC sssF screen forward
1128 TTCTTCATTTAGTTTACCCATATCAAC sssF screen reverse
839 GCTAGGATCCTCCATCTAATTCAAATGACAACG sssF cloning forward. Contains BamHI site (underlined)
840 ACTAGGATCCGCTCCATTCAAAGTTCCACTTAC sssF cloning reverse. Contains BamHI site (underlined)
873 GCTCACTCGAGTTCGACACCATCAGTAGAAGC sssF fragment PCR for cloning into pBAD/HisB, for antibody production, forward. Contains XhoI site (underlined)
874 GCTCGGAATTCAAGCGCTTTAGCTTTAGCATC sssF fragment PCR for cloning into pBAD/HisB, for antibody production, reverse. Contains EcoRI site (underlined)
1001 AAAAAAGCTTATAATTATCCTTAAGTCACTACTATGTGCGCCCAGATAGGGTG sssF TargeTron IBS
1002 CAGATTGTACAAATGTGGTGATAACAGATAAGTCTACTATCTTAACTTACCTTTCTTTGT sssF TargeTron EBS1d
1003 TGAACGCAAGTTTCTAATTTCGATTTGACTTCGATAGAGGAAAGTGTCT sssF TargeTron EBS2
2065 AAAAAAGCTTATAATTATCCTTATCGTACGGCAAGGTGCGCCCAGATAGGGTG sasF TargeTron IBS
2066 CAGATTGTACAAATGTGGTGATAACAGATAAGTCGGCAAGATTAACTTACCTTTCTTTGT sasF TargeTron EBS1d
2067 TGAACGCAAGTTTCTAATTTCGGTTTACGATCGATAGAGGAAAGTGTCT sasF TargeTron EBS2
2084 CAGTAAGCTTTGTTAGCGACATGGACAATATG sasF cloning forward. Contains HindIII site (underlined)
2085 CCGTAAGCTTTTGCATATACTTCACAATAAATTAAGG sasF cloning reverse. Contains HindIII site (underlined)
1011 TTCTTTAGGTGATGAACATATCAGG Sequencing primer to check for correct 350 bp retargeted intron fragments for TargeTron
EBSU CGAAATTAGAAACTTGCGTTCAGTAAAC TargeTron EBS universal