Skip to main content

Table 2 Primers used for construction

From: Construction of Bordetella pertussis strains with enhanced production of genetically-inactivated Pertussis Toxin and Pertactin by unmarked allelic exchange

Name Sequence
5'F-PT-SalI GCGGTCGACGGCGCGCAATGCGGCGCGGAC
5'R-PT-MCS GGGGGCGGCCGCGAGATCTCTCTAGACGGTACCATCGCGCGACTTTGCGCCGAAGGA
3'F-PT-XbaI CGTTCTAGACCTGGCCCAGCCCCGCCCAAC
3'R-PT-BglII GGCAGATCTGCAGTTCGAGCAGATCGCCGG
CmF-KpnI CGCGGTACCTGATGTCCGGCGGTGCTTTTG
CmR-XbaI AATCTAGATATCGTCAATTATTACCTCCAC
S1F-PT-KpnI GATGGTACCGGTCACCGTCCGGACCGTGCT
S1R-PT-XbaI CAGGTCTAGAACGAATACGCGATGCTTTCG
R-R9K GGGCGGGAGTCATACTTGTATACGGTGGCGG
F-R9K CCGCCACCGTATACAAGTATGACTCCCGCCC
F-E129G CCACCTACCAGAGCGGGTATCTGGCACACCGG
R-E129G CCGGTGTGCCAGATACCCGCTCTGGTAGGTGG
5'F-PD-ApaI GGAGGGCCCATGAAACTCGTCATCGCCATCATCAAGCCC
5'R-PD-MCS TACGGTACCGGATCCCGCATCGCAACAACGGGGTCATCGCGACCC
3'F-PD-MCS CGTTCTAGAACTAGTCCGCTACCAGGTGTAGCGATAGCCCAGGTG
3'R-PD-BglII TGTAGATCTCGGCGAGATACTTGCGTTTCGGCGTTGTCG
PtxF-BamHI TTGGGATCCCAGCGCAGCCCTCCAACGCGCCATCC
PtxR-MCS TCTACTAGTAAGAATTCTCGCGGTATCCGTCAAGGAAAAACATGGAC
TerF-EcoRI GCGGAATTCCGCCTGCCGCCTGCACGCAT
TerR-SpeI TCCACTAGTCAAGGGCATCGGGCGCCGGC
5'F-PD2-SpeI CGCACTAGTCTATTCCAGCGGCGGGTCGAAATGGC
5'R-PD2-MCS CCCCAGGCGGCCGCTGTCTAGAGTGGATCCCAGGCCGATGCGTCCGCCGTGCAGGC
3'F-PD2-XbaI ATCTCTAGAATGGGCACCTCGGCCACGCTGGCGCTG
3'R-PD2-NotI AAGTATGCGGCCGCATGAGCGAAACCCTGTTGAAAGTATC
CmF-BamHI CGCGGATCCTGATGTCCGGCGGTGCTTTTG
FHAproF-BamHI TCTGGATCCCTGCGCTGGCACCCGCGGCGGGCCG
FHAR-MCS GCCTCTAGATTCATATGATTCCGACCAGCGAAGTGAAGTAAT
PRNF-NdeI CTGGTCGGCATATGAACATGTCTCTGTCACGCATTG
PRNF ATGAACATGTCTCTGTCACGCATTGTCAAGG
PRNR-XbaI GCCTCTAGAGCCTGGAGACTGGCACCGGCCAAGC
PrnProF-BamHI CGGGGATCCGCACCCTGGCCTGCGGGGCGGGACC
PRNProR-NdeI AGACATGTTCATATGGATGCCAGGTGGAGAGCAGA
5'F-int CTAGCGTTCGCATACCAAATCCTTGC
5'RCM-int CCGTAATATCCAGCTGAACGGTCTGG
3'FCM-int TCTGTGATGGCTTCCATGTCGGCAG
3'R-int AGCATGTTGCGGTGTTCCCGGAATG
5'FPD-int ATGACGGAAAGCCGCATGGGCATTGGGTCC
3'RPD-int TTCGTACGTGTTCAGGTGCCGATTGCCGG
5'FPD2-int TGGGCTGGCTGTTCTGGCACGAAACG
3'RPD2-int TTCATCGAATCGGCGCTGATCCTGGC
PRNF-int AGGTGCAGCCATACATCAAGGCCAGC
  1. Sequences with bold letters are the recognition sites for various restriction enzymes used for each construction. Underlined sequences are the sequences of the new codons used for constructing mutant