Skip to main content

Table 2 Bacteria and plasmids used in this study

From: Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum

Strain, plasmid or oligonucleotide Relevant characteristics or sequence Source, reference, or purpose
E. coli strains   
DH5α   Culture collection
C. glutamicum strains
ATCC 13032 WTa Culture collection
Plasmids   
pEKEx3 SpecR [48]
pEKEx3-bioYMN pEKEx3 containing bioY, bioM and bioN This work
pGEM-T-easy cloning vector, AmpR Promega
Oligonucleotides   
bio-operon_fw GATCTAGAATTCAAATTTCAGCCCCCATCC This work
bio-operon_rev GATCTAGGATCCCTGACCGCTGGTAACAAG This work
bioYMN-RBS_fw AAGGAGATATAGATTTGTTGAACACTGTTCAGGTG This work
bioMN-RBS_fw AGGAGATATAGATATGCCCGAGATCATTTTTGACAACAC This work
bioYMN_rev TTAATCGCCGGCACCACGTGC This work
bioY_rev CTATTTCTTACGGATGTCAGGGAATGC This work
bioM_rev TCATTTCGCAGGTTCCGCC This work
bioY-int_fw CACAGCGGGAGTGCCTATTGTTTT This work
bioY-int_rev GAAGGACGAGACCCACGATG This work
bioM-int_rev CAGCGATGATCACTTCTGGCTC This work
dnaE-fw TGCCCTTCCGGCGATGTCCAA [48]
dnaE-rev CTGGAACCATGTCGTCCTAGAG [48]
  1. a WT wild type