Skip to main content

Table 2 PCR primers used in this study

From: Re-evaluation of the significance of penicillin binding protein 3 in the susceptibility of Listeria monocytogenes to β-lactam antibiotics

Primer Sequence (5'→ 3')
HlyAa GCGGGTACCAGGTAGAGCGGACATCCATTG
HlyBb, c, d GTTTTA GGATCC CCCGGGGGGTTTCACTCTCCTTCTAC
HlyCb, c CCCGGG GGATCCTAAAACCGCTTAACACACACG
HlyDe GCGTCTAGATTCTTCCCCGACAGAATCTGC
NisR F CCCACTAAACAATCGGAGG
NisK Rc GCGGGATCCCAGAAATTAAACCAAACAAAATTTTC
Oepbp3 F CGTGAAACTAAATTTTAGAAAAAAGAAAAAAG
Oepbp3 Rf GCGGCATGCGATTAATTTTCGGTTTGTTCTGATTG
  1. a Nucleotide substitutions to create KpnI site are underlined
  2. b Nucleotide substitutions to create SmaI site are underlined
  3. c Nucleotide substitutions to create BamHI site are in boldface
  4. d Overhang complementary to SOE primer is in italics
  5. e Nucleotide substitutions to create XbaI site are underlined
  6. f Nucleotide substitutions to create SphI site are underlined