Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study

From: Activation of the RpoN-RpoS regulatory pathway during the enzootic life cycle of Borrelia burgdorferi

Gene Forward (5'-3') Reverse (5'-3')
Cloning   
flaB GGGAACTTGATTAGCCTGCGCAAT TCGAGCTTCTGATGATGCTGCT
rpoS CTTGCAGGACAAATACAAAGAGGC TGGGACTATTGTCCAGGTTATATCTTT
ospC CTGCTGATGAGTCTGTTAAAGGGC TTTGGACTTTCTGCCACAACAGGG
ospA GCGTTTCAGTAGATTTGCCTGGTG CCCTCTAATTTGGTGCCATTTGAGTCG
dbpA CTTATATCATGTGGACTAACAGGAGC AGCACTCCTTGAGCTGTAGTTGGA
qRT-PCR   
flaB TGATTAGCCTGCGCAATCATT AATGACAGATGAGGTTGTAGCAGC
rpoS CTGGACAAAGAAATAGAGGGATCTG CAAGGGTAATTTCAGGGTTAAAAGAA
ospC GTACTAAAACTAAAGGTGCTGAAGAA GCATCTCTTTAGCTGCTTTTGACA
ospA GGCGTAAAAGCTGACAAAAGTAAAGT TGTTTTGCCATCTTCTTTGAAAAC
dbpA ACGAAGCGCTAAAGACATTACAGA GGCATCAAAATTTACGCCCTTA