Skip to main content

Advertisement

Table 1 Primers employed for Real-Time PCR

From: Impact of antibiotic treatments on the expression of the R plasmid tra genes and on the host innate immune activity during pRAS1 bearing Aeromonas hydrophila infection in zebrafish (Danio rerio)

Target gene Sequence (5' to 3') Reference or GenBank accession no.
E. coli 16S rDNA F GCAGGCCTAACACATGCAAGTC [30]
  R TGCTGCCTCCCGTAGGAGT  
traD F ACGCCTCCTGTTCTGTTTCA [DQ401103.1]
  R ATCAGCCCGGTCAGATTGT  
virB11 F GGATCAACTCAGCCACAAAAA [DQ401103.1]
  R CACCGTTCCGCTGTTCTATT  
virD4 F GTTGTCCAGGGTAGCAGCAG [DQ401103.1]
  R TGGACAACCAGGAACAAGC  
dfr16 F GACCTCATCCTCCGATGG [AJ517790.2]
  R TGGTCGGAGATATGGGTATAGAA  
C3 F CGGACGCTGACATCTACCAA [25]
  R TCCAGGTCTGCTCTCCCAAG  
IL-1β F ATCAAACCCCAATCCACAGAGT [25]
  R GGCACTGAAGACACCACGTT  
IL-8 F TGTTTTCCTGGCATTTCTGACC [24]
  R TTTACAGTGTGGGCTTGGAGGG  
TNF α F ACCAGGCCTTTTCTTCAGGT [10]
  R TGCCCAGTCTGTCTCCTTCT  
ef1α F TGCCTTCGTCCCAATTTCAG [24]
  R TACCCTCCTTGCGCTCAATC