Skip to main content

Table 4 Primers used in this study

From: Identification of a ferritin-like protein of Listeria monocytogenesas a mediator of β-lactam tolerance and innate resistance to cephalosporins

Primer Sequence [5 → 3]
16S RNA-Ea TTAGCTAGTTGGTAGGGT
16S RNA-Ba AATCCGGACAACGCTTGC
0943Fab CATTGGTATATGAGAGGCCAC
0943Rab CATTGTCGCCTTCTTTGTCAG
0944Fab ATGGTTTCATGATGAGTTTGATGT
0944R2b ATTTTCCAGTCGTGGTCTTTG
0944Rac TCCGTTTTTGGTTCATAGTCG
0945Fab CCGCACGCAGACCATATTG
0945R2b ATTGGCACCGCTATCTACC
0945Rac CTGGTTGGATGTGGACGATC
1065Fa GCTTGAAGCACGCATGACC
1065Ra GCCGTCATGCACAGGATAC
1211Fa CAGGTTTGTTAGCTGGGATG
1211Ra ACGCCAAGTAGACGTTCGA
1622Fa TAGCGTCAACCGTCCTGCT
1622Ra ATCTCCCATACCGCCAGTG
1660Fa TACCGCGTACGCAGATCG
1660Ra GAATCAACACGTAGTCCGC
1941Fa CCGGCTGATTATGACATGAG
1941Ra TGCTTTCTCGGCAGCAGC
2501Fa GTGGTGACAGCTGAAGATG
2501Ra GTGGTGACAGCTGAAGATG
2820Fa GCCTTGTCGCTTCGTGTG
2820Ra ACTAAGACAACGGGCAGTC
llo-1d CGGGTACCAGGTAGAGCGGACATCCATTG
llo-2e GTTTTAGGATCCCCCGGGGGGTTTCACTCTCCTTCTAC
llo-3 CCCGGGGGATCCTAAAACCGCTTAACACACACG
llo-4f GCGTCTAGATTCTTCCCCGACAGAATCTGC
phoP-1g CAGGATCCAGTTTTGGGTGCTCGTGC
phoP-2h TCGAATTCCTATCTACCATCTTCAGCTGTCAC
phoP-3h TCGAATTCGGACTTGAACTTGGAGCAG
phoP-4 i CGTCCATGGTTACGTTCTCCATTTTATAACCG
axyR-1 g CAGGATCCGGTAGCGATTAATTTTCACGAC
axyR-2 h TCGAATTCCTAATCATTGACTTCTTTCCTAGCAGA
axyR-3 h TCGAATTCCTTATGCTAGTGAACTGGAATAC
axyR-4 i CTCCCATGGCCGTAATCGTCTCATCGCTC
Hly-1 g GCGGGATCCTGTAGAAGGAGAGTGAAACCCATG
Hly-2 j GCGGTCGACACAATTATTCGATTGGATTATCTAC
seq-1 CAGGAAACAGCTATGACCATG
seq-2 ACTAATATAAGTGTAATAAAAACTAGCAT
  1. a Primers used for analysis of gene expression under stress conditions.
  2. b Primers used for PCR in cotranscription analysis.
  3. c Primer used for reverse transcription in cotranscription analysis.
  4. d The sequence in boldface type is the KpnI restriction enzyme site.
  5. e The underlined sequence is an overhang complementary to primer llo-3.
  6. f The sequence in boldface type is the XbaI restriction enzyme site.
  7. g The sequence in boldface type is the BamHI restriction enzyme site.
  8. h The sequence in boldface type is the EcoRI restriction enzyme site.
  9. i The sequence in boldface type is the NcoI restriction enzyme site.
  10. j The sequence in boldface type is the SalI restriction enzyme site.