Skip to main content

Table 1 Primers used for qRT-PCR analysis

From: Assessment of virulence diversity of methicillin-resistant Staphylococcus aureus strains with a Drosophila melanogaster infection model

Primers Sequence (5' to 3') Ref
rp 49 F GACGCTTCAAGGGACAGTATCTG [18]
rp 49 R AAACGCGGTTCTGCATGAG [18]
dpt- F GCTGCGCAATCGCTTCTACT [18]
dpt- R TGGTGGAGTGGGCTTCATG [18]
dro-F CGTGAGAACCTTTTCCAATATGATG [18]
dro-R TCCCAGGACCACCAGCAT [18]
cec A1-F TCTTCGTTTTCGTCGCTCTC [18]
cec A1-R CTTGTTGAGCGATTCCCAGT [18]
hla-F CTGATTACTATCCAAGAAATTCGATTG This study
hla-R CTTTCCAGCCTACTTTTTTATCAGT This study
hlg-F ATAGAAGATATCGGCCAAGG This study
hlg-R TTGCATCTTAACAACTAGGGC This study
sak-F GACGCGAGTTATTTTGAACC This study
sak-R TCTTTTGTAAGTGTAGTCCCAGG This study
hys A-F GTTTGATGCTACA GAGAAAGAGG This study
hys A-R CTGCGATTTTCTCAATATTACG This study
ssp A- F GGGT TATTAGGTTG GTCATCG This study
ssp A-R AAGTGATCGGAATTCATTGG This study
gyr B-F ATCGACTTCAGAGAGAGGTTTG [19]
gyr B-R CCGTTATCCGTTACTTTAATCCA [19]