Skip to main content

Table 3 SNPs found in gyrA and gyrB genes for M. avium subsp. paratuberculosis strain K-10 and M. avium subsp. paratuberculosis types I and III

From: Inter- and Intra-subtype genotypic differences that differentiate Mycobacterium avium subspecies paratuberculosisstrains

Strains Type IS900RFLP profiles gyrA gyrB
position 1822 1986 1353 1626
K10* II R01 CCCGAGGAGCGGATCGCT- ACTCGTGGGCGCGGTGTTGT CCGGTCGACCGATCCGCGC- CCAGCACATCTCGACGCTGT
6756 I S1 .....A....- .......... ......C...- ..........
6759 I S1 .....A....- .......... ......C...- ..........
P133/79 I S2 .....A....- .......... ......C...- ..........
21P I S2 .....A....- .......... ......C...- ..........
235 G I S2 .....A....- .......... ......C...- ..........
M189 I S2 .....A....- .......... ......C...- ..........
M15/04 I S2 .....A....- .......... ......C...- ..........
M254/04 I S2 .....A....- .......... ......C...- ..........
M71/03 I S2 .....A....- .......... ......C...- ..........
M72/03 I S2 .....A....- .......... ......C...- ..........
22 G III A .....A....- .....T..... ......C...- .....T.....
OVICAP16 III A .....A....- .....T..... ......C...- .....T.....
OVICAP49 III A .....A....- .....T..... ......C...- .....T.....
21I III B .....A....- .....T..... ......C...- .....T.....
PCR311 III B .....A....- .....T..... ......C...- .....T.....
19I III C .....A....- .....T..... ......C...- .....T.....
85/14 III C .....A....- .....T..... ......C...- .....T.....
OVICAP34 III D .....A....- .....T..... ......C...- .....T.....
18I III E .....A....- .....T..... ......C...- .....T.....
FO21 III F .....A....- .....T..... ......C...- .....T.....
LN20 III I1 .....A....- .....T..... ......C...- .....T.....
269OV III I10 .....A....- .....T..... ......C...- .....T.....
M284/08 III I10 .....A....- .....T..... ......C...- .....T.....
P465 III I2 .....A....- .....T..... ......C...- .....T.....
Consensus I   CCCGAGGAGAGGATCGCT- ACTCGTGGGCGCGGTGTTGT CCGGTCGACCGACCCGCGC- CCAGCACATCTCGACGCTGT
Consensus III   CCCGAGGAGAGGATCGCT- ACTCGTGGGTGCGGTGTTGT CCGGTCGACCGACCCGCGC- CCAGCACATTTCGACGCTGT
K10 II   CCCGAGGAG C GGATCGCT- ACTCGTGGG C GCGGTGTTGT CCGGTCGACCGA T CCGCGC- CCAGCACAT C TCGACGCTGT
  1. *K10 sequenced strain type II used as sequence reference.