Skip to main content

Table 2 Sequences of the Primers used in this study

From: Isolimonic acid interferes with Escherichia coli O157:H7 biofilm and TTSS in QseBC and QseA dependent fashion

Primer Sequence (5’-3’) Reference
Forward Reverse
cesD GTTTATCAAATCATGAAGATGCACAA GCCCTGGGATCTTGCATAAC [23]
escJ CCAATGATGTCAATGTTTCCAAA GCGCGAACAAAATCCTCTTT [23]
escR GCCAGCCTCCAACAAGAATG ATTGGCCTTGGGTATGATGATG [23]
escU TCCACTTTGTATCTCGGAATGAAG CAAGGATACTGATGGTAACCCTGAA [23]
flhC CGCTTTCCAGCATCTGCAA CGGGATATTCAGCTGGCAAT [23]
flhD TCATTCAGCAAGCGTGTTGAG TCCCGCGTTGACGATCTC [23]
ler CGACCAGGTCTGCCCTTCT TCGCTCGCCGGAACTC [23]
sepZ CGGAGACGAGCAGCACAGA CCGCCAACCGCAGTAAGA [23]
stx2 ACCCCACCGGGCAGTT GTCAAAACGCGCCTGATAGAC [23]
rpoA GTTGCCGCACGACGAATCGC CCCAATCGGCCGTCTGCTGG This study
qseC CAGTCCACAGGGCAGCGTGG AGTCCACTGCCGGTAGCGGT This study
qseB GAGCTGCGCCACGGTAACGT AGTTTGCGCGGCAGTACCCG This study
qseA CCAGCCCCCGACCTGATTGC GCGGGATCAGGCGAGTCGAG This study
qseB (cloning) GTGCTGTACAGAGCTC GTTACAAC CCAGGCGACAAAGCTT GAAAGCA This study
qseC (cloning) TGCGTCTGGGAGCTC ACGATTATC GGTGAGACGTTTGTCGAC TATAGTACG This study
  1. The underlined segment in AV25/26 and AV29/30 indicate the restriction enzyme sites.