Skip to main content

Advertisement

Table 4 Oligonucleotides used in this work

From: Dual role of HupF in the biosynthesis of [NiFe] hydrogenase in Rhizobium leguminosarum

Primer Sequence (5-3) Use
HUPF5 GCGGCACTGCTGGTCGGCTGAATCACTCCCAAGGCTGAGGTGTAGGCTGGAGCTGCTTC hupF deletion
HUPF3 CGGCGGCAATTCCGGCTCGCGGGAAATGAGATCGGCGAACATATGAATATCCTCCTTAGT
HUPK52 ACATTCCTTCTCGGGGCCGGCACGATAGGGATCGACGTGATTCCGGGGATCCGTCGACC hupK deletion
HUPK32 TGCGATAGGCTGCGAGCCTGCCGTCACCGCCGATTTCGAGTGTAGGCTGGAGCTGCTTC
HYPC5 GAACGAACATGCATCAATCGAGGAGAACCGGACATGTGCATTCCGGGGATCCGTCGACC hypC deletion
HYPC3 TCGTCGATATATTTCATGCCGCATCTCCCATCGCACGTTGTGTAGGCTGGAGCTGCTTC
TAGF31 TCCCGCGAGCCGGAATTGCCGCCGCATTTGCGCGGCGAGTGGAGCCACCCGCAGTTCGA Generation of hupF ST fusion (pALPF382)
TAGF32 GGTGGAAACTCAAATTCCATTTTGGAAGTTCTCTTTTCAATATGAATATCCTCCTTAGT
FNDE CTGTCAGTCGTCATATGTGCATCGGCATTCCCAT Generation of pPM501/pPM501C plasmids
MANG3 ACGGCGGCGGGAATGCTC
HUPF-3413  L-Strep GAGTACTCTCAGGCGCCTTTTTCGAACTGCGGGTGGCTCCAGCTAGCTCCCTCCACCGCTTCGGCAAGTCCGGCGAG Generation of pPM501C plasmid