Skip to main content

Table 1 Primers used in this study

From: Effect of environmental stress factors on the uptake and survival of Campylobacter jejuni in Acanthamoeba castellanii

Primer names Primer sequences (5-3) Amplicons (bp) References
16S RNA-F AACCTTACCTGGGCTTGATA   
16S RNA-R CTTAACCCAACATCTCACGA 122 [34]
ciaB-F ATATTTGCTAGCAGCGAAGAG   
ciaB-R GATGTCCCACTTGTAAAGGTG 157 [34]
dnaJ-F AGTGTCGAGCTTAATATCCC   
dna-R GGCGATGATCTTAACATACA 117 [34]
htrA-F CCATTGCGATATACCCAAACTT   
htrA-R CTGGTTTCCAAGAGGGTGAT 130 This study